Review



pgex 6p 3 pml bbox1 f158e 120 168  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 91
      Buy from Supplier

    Structured Review

    Addgene inc pgex 6p 3 pml bbox1 f158e 120 168
    Pgex 6p 3 Pml Bbox1 F158e 120 168, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgex+6p+3+pml+bbox1+f158e+120+168/mCh-BICD2*-strep+(Plasmid+%23120168)/pm37473756-690-192-195
    Average 91 stars, based on 2 article reviews
    pgex 6p 3 pml bbox1 f158e 120 168 - by Bioz Stars, 2026-10
    91/100 stars

    Images

    Related Articles

    Virus:

    Article Title: Conformational exchange at a C 2 H 2 zinc-binding site facilitates redox sensing by the PML protein.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal mouse anti-b-actin antibodies AC-15 Sigma A5441 Polyclonal rat anti-GFP antibodies This paper N/A Bacterial and virus strains E. coli BL21(DE3) ThermoFisher Scientific EC0114 Chemicals, peptides, and recombinant proteins Turbo3C protease Accelagen H0101S 4-(2-pyridylazo)resorcinol (PAR) ThermoFisher Scientific 176320050 PMLI B-box1 domain (120-168) This paper N/A C4C4 mutant of PMLI B-box1 domain (120-168) This paper N/A W157E mutant of PMLI B-box1 domain (120-168) This paper N/A F158E mutant of PMLI B-box1 domain (120-168) This paper N/A PMLI RING domain (49-104) This paper N/A Experimental models: Cell lines PML-/- U2OS cell line Collin et al.58 N/A Oligonucleotides Primer W157E forward: 5’-AGTTTCTGAAACACGAGGCGC-3’ IDT Technologies Custom synthesis Primer W157E reverse: 5’-CTTGGTGCGCTTCGAAGCAC-3’ IDT Technologies Custom synthesis Primer F158E forward: 5’-AGCTGAAACACGAGGCGCG-3’ IDT Technologies Custom synthesis Primer F158E reverse: 5’-CCCATTGGTGCGCTTCGAA-3’ IDT Technologies Custom synthesis Primer PMLI H155C forward: 5’-CAAGTGCTTCGAGGCATGCCA GTGGTTCCTCAAG-3’ IDT Technologies Custom synthesis Primer PMLI H155C reverse: 5’-CTTGAGGAACCACTGGCATGC CTCGAAGCACTTG-3’ IDT Technologies Custom synthesis Primer PMLI H161C forward: 5’- GTGGTTCCTCAAGTGCGAGGCCCGGCC -3’ IDT Technologies Custom synthesis Primer PMLI H161C reverse: 5’- GGCCGGGCCTCGCACTTGAGGAACCAC -3’ IDT Technologies Custom synthesis Recombinant DNA pGEX-6p-3-PML-Bbox1(120-168) This paper AddGene #185632 pGEX-6p-3-PML-Bbox1-C4C4(120-168) This paper AddGene #185640 pGEX-6p-3-PML-Bbox1-W157E(120-168) This paper AddGene #185641 pGEX-6p-3-PML-Bbox1-F158E(120-168) This paper AddGene #185642 pGEX-6p-3-PML-RING(49-104) This paper AddGene #185631 (Continued on next page) e1 Structure 31, 1086–1099.e1–e6, September 7, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER pLNGY-PML.I Cuchet at al.21 N/A pLNGY-PML.I C4C4 mutant This paper N/A Software and algorithms GraphPad Prism 8 Dotmatics https://www.graphpad.com/ SEDANAL Stafford et al.59 https://sedanal.org/ SEDNTERP Laue et al.60 http://www.bitc.unh.edu/sednterp SedFit Schuck et al.61 https://sedfitsedphat.nibib.nih.gov/ software/default.aspx GUSSI Brautigam et al.62 http://biophysics.swmed.edu/MBR/ software.html NMRPipe Delaglio et al.63 https://www.ibbr.umd.edu/nmrpipe/ install.html SPARKY Lee et al.64 https://www.cgl.ucsf.edu/home/sparky/ DASHA Orekhov et al.65 N/A Cpmg_fit Korzhnev et al.37,66 N/A PyMol Schrödinger https://pymol.org/2/ ImageJ Schindelin et al.67 https://imagej.net/downloads Matlab MathWorks https://www.mathworks.com/products/ matlab.html

    Recombinant:

    Article Title: Conformational exchange at a C 2 H 2 zinc-binding site facilitates redox sensing by the PML protein.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal mouse anti-b-actin antibodies AC-15 Sigma A5441 Polyclonal rat anti-GFP antibodies This paper N/A Bacterial and virus strains E. coli BL21(DE3) ThermoFisher Scientific EC0114 Chemicals, peptides, and recombinant proteins Turbo3C protease Accelagen H0101S 4-(2-pyridylazo)resorcinol (PAR) ThermoFisher Scientific 176320050 PMLI B-box1 domain (120-168) This paper N/A C4C4 mutant of PMLI B-box1 domain (120-168) This paper N/A W157E mutant of PMLI B-box1 domain (120-168) This paper N/A F158E mutant of PMLI B-box1 domain (120-168) This paper N/A PMLI RING domain (49-104) This paper N/A Experimental models: Cell lines PML-/- U2OS cell line Collin et al.58 N/A Oligonucleotides Primer W157E forward: 5’-AGTTTCTGAAACACGAGGCGC-3’ IDT Technologies Custom synthesis Primer W157E reverse: 5’-CTTGGTGCGCTTCGAAGCAC-3’ IDT Technologies Custom synthesis Primer F158E forward: 5’-AGCTGAAACACGAGGCGCG-3’ IDT Technologies Custom synthesis Primer F158E reverse: 5’-CCCATTGGTGCGCTTCGAA-3’ IDT Technologies Custom synthesis Primer PMLI H155C forward: 5’-CAAGTGCTTCGAGGCATGCCA GTGGTTCCTCAAG-3’ IDT Technologies Custom synthesis Primer PMLI H155C reverse: 5’-CTTGAGGAACCACTGGCATGC CTCGAAGCACTTG-3’ IDT Technologies Custom synthesis Primer PMLI H161C forward: 5’- GTGGTTCCTCAAGTGCGAGGCCCGGCC -3’ IDT Technologies Custom synthesis Primer PMLI H161C reverse: 5’- GGCCGGGCCTCGCACTTGAGGAACCAC -3’ IDT Technologies Custom synthesis Recombinant DNA pGEX-6p-3-PML-Bbox1(120-168) This paper AddGene #185632 pGEX-6p-3-PML-Bbox1-C4C4(120-168) This paper AddGene #185640 pGEX-6p-3-PML-Bbox1-W157E(120-168) This paper AddGene #185641 pGEX-6p-3-PML-Bbox1-F158E(120-168) This paper AddGene #185642 pGEX-6p-3-PML-RING(49-104) This paper AddGene #185631 (Continued on next page) e1 Structure 31, 1086–1099.e1–e6, September 7, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER pLNGY-PML.I Cuchet at al.21 N/A pLNGY-PML.I C4C4 mutant This paper N/A Software and algorithms GraphPad Prism 8 Dotmatics https://www.graphpad.com/ SEDANAL Stafford et al.59 https://sedanal.org/ SEDNTERP Laue et al.60 http://www.bitc.unh.edu/sednterp SedFit Schuck et al.61 https://sedfitsedphat.nibib.nih.gov/ software/default.aspx GUSSI Brautigam et al.62 http://biophysics.swmed.edu/MBR/ software.html NMRPipe Delaglio et al.63 https://www.ibbr.umd.edu/nmrpipe/ install.html SPARKY Lee et al.64 https://www.cgl.ucsf.edu/home/sparky/ DASHA Orekhov et al.65 N/A Cpmg_fit Korzhnev et al.37,66 N/A PyMol Schrödinger https://pymol.org/2/ ImageJ Schindelin et al.67 https://imagej.net/downloads Matlab MathWorks https://www.mathworks.com/products/ matlab.html

    Mutagenesis:

    Article Title: Conformational exchange at a C 2 H 2 zinc-binding site facilitates redox sensing by the PML protein.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal mouse anti-b-actin antibodies AC-15 Sigma A5441 Polyclonal rat anti-GFP antibodies This paper N/A Bacterial and virus strains E. coli BL21(DE3) ThermoFisher Scientific EC0114 Chemicals, peptides, and recombinant proteins Turbo3C protease Accelagen H0101S 4-(2-pyridylazo)resorcinol (PAR) ThermoFisher Scientific 176320050 PMLI B-box1 domain (120-168) This paper N/A C4C4 mutant of PMLI B-box1 domain (120-168) This paper N/A W157E mutant of PMLI B-box1 domain (120-168) This paper N/A F158E mutant of PMLI B-box1 domain (120-168) This paper N/A PMLI RING domain (49-104) This paper N/A Experimental models: Cell lines PML-/- U2OS cell line Collin et al.58 N/A Oligonucleotides Primer W157E forward: 5’-AGTTTCTGAAACACGAGGCGC-3’ IDT Technologies Custom synthesis Primer W157E reverse: 5’-CTTGGTGCGCTTCGAAGCAC-3’ IDT Technologies Custom synthesis Primer F158E forward: 5’-AGCTGAAACACGAGGCGCG-3’ IDT Technologies Custom synthesis Primer F158E reverse: 5’-CCCATTGGTGCGCTTCGAA-3’ IDT Technologies Custom synthesis Primer PMLI H155C forward: 5’-CAAGTGCTTCGAGGCATGCCA GTGGTTCCTCAAG-3’ IDT Technologies Custom synthesis Primer PMLI H155C reverse: 5’-CTTGAGGAACCACTGGCATGC CTCGAAGCACTTG-3’ IDT Technologies Custom synthesis Primer PMLI H161C forward: 5’- GTGGTTCCTCAAGTGCGAGGCCCGGCC -3’ IDT Technologies Custom synthesis Primer PMLI H161C reverse: 5’- GGCCGGGCCTCGCACTTGAGGAACCAC -3’ IDT Technologies Custom synthesis Recombinant DNA pGEX-6p-3-PML-Bbox1(120-168) This paper AddGene #185632 pGEX-6p-3-PML-Bbox1-C4C4(120-168) This paper AddGene #185640 pGEX-6p-3-PML-Bbox1-W157E(120-168) This paper AddGene #185641 pGEX-6p-3-PML-Bbox1-F158E(120-168) This paper AddGene #185642 pGEX-6p-3-PML-RING(49-104) This paper AddGene #185631 (Continued on next page) e1 Structure 31, 1086–1099.e1–e6, September 7, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER pLNGY-PML.I Cuchet at al.21 N/A pLNGY-PML.I C4C4 mutant This paper N/A Software and algorithms GraphPad Prism 8 Dotmatics https://www.graphpad.com/ SEDANAL Stafford et al.59 https://sedanal.org/ SEDNTERP Laue et al.60 http://www.bitc.unh.edu/sednterp SedFit Schuck et al.61 https://sedfitsedphat.nibib.nih.gov/ software/default.aspx GUSSI Brautigam et al.62 http://biophysics.swmed.edu/MBR/ software.html NMRPipe Delaglio et al.63 https://www.ibbr.umd.edu/nmrpipe/ install.html SPARKY Lee et al.64 https://www.cgl.ucsf.edu/home/sparky/ DASHA Orekhov et al.65 N/A Cpmg_fit Korzhnev et al.37,66 N/A PyMol Schrödinger https://pymol.org/2/ ImageJ Schindelin et al.67 https://imagej.net/downloads Matlab MathWorks https://www.mathworks.com/products/ matlab.html



    Similar Products

    pgex 6p 3 pml bbox1 f158e 120 168  (Addgene inc)
    91
    Addgene inc pgex 6p 3 pml bbox1 f158e 120 168
    Pgex 6p 3 Pml Bbox1 F158e 120 168, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgex+6p+3+pml+bbox1+f158e+120+168/mCh-BICD2*-strep+(Plasmid+%23120168)/pm37473756-690-192-195
    Average 91 stars, based on 1 article reviews
    pgex 6p 3 pml bbox1 f158e 120 168 - by Bioz Stars, 2026-10
    91/100 stars
    		  Buy from Supplier

    Image Search Results